Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primer sequences for MLST analysis

From: Exploration of genetic diversity of Bacillus spp. from industrial shrimp ponds in Vietnam by multi-locus sequence typing

Primer Sequence (5′–3′) Annealing temperature Expected size
rpoD-F GCCGAAGAAGAATTTGACCTTAA 54 °C 854 bp
rpoD-R CGTTTRCTTCTGCTHGGATGTCT
glpF-F WTGACAGCATTTTGGGG 54 °C 690 bp
glpF-R GTAAAATACRCCGCCGA
ilvD-F ATGAGATATTCGCTGCC 54 °C 622 bp
ilvD-R CTTCGTTAATGCGTTCTAAAGAG
ptA-F ATACATATGAAGGSATGGAAGA 54 °C 610 bp
ptA-R TAGCCGATGTTTCCTGCT
tpiA-F TCAGCTTCGTTGAAGAAGTGAAA 54 °C 620 bp
tpiA-R GGACTCTGCCATATATTCTTTA
PycA-F AAATCAGARGCGAAAGC 54 °C 545 bp
PycA-R CCTGAGCGGTAAGCCAT
purH-F TTTGAGAAAAAACAATCGCT 54 °C 568 bp
purH-R TCGGCTCCCTTTTCGTCGG