Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 PCR primers used in this study

From: Monitoring of emaciation disease in cultured Paralichthys olivaceus of Jeju island during 2014–2015

Primer Oligonucleotide sequence (5′-3′) Expected size Reference
EM-F CAACCGCAATGTGTTTACTC 812 bp Kim et al. (2015)
EM-R CCAAACAACCTGCCACAATG