Skip to main content

Table 3 PCR primers used in this study

From: Monitoring of emaciation disease in cultured Paralichthys olivaceus of Jeju island during 2014–2015

Primer Oligonucleotide sequence (5′-3′) Expected size Reference
EM-F CAACCGCAATGTGTTTACTC 812 bp Kim et al. (2015)