Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotide primers used in PCR amplification of ARF1b of P. olivaceus; F, Forward; R, reverse

From: Cloning and characterization of ADP-ribosylation factor 1b from the olive flounder Paralichthys olivaceus

Primer name 5'-3' sequence Information
DgARF1b-F1 ATGGGDRMYWTBKCYWSC Primers for cDNA library screening
DgARF1b-F2 GACVACCATCYTGTACAARCTCAAAC
DgARF1b-R1 CAYTTBVYDTTYYTBAGCTKG
DgARF1b-R2 CRTCYTCWGMCARCATTCGCATC
3′GSP-PoARF1b-F1 GTTGAGACAGTAGAGTACAGGAACATCAG
3′GSP-PoARF1b-F2 GGAGCGAATCGGTGAGGCGAGAGAGGAGC
5′GSP-PoARF1b R1 CAGTTCCGCCGGGTGAGGTCGTGCAGGC
5′GSP-PoARF1b R2 GCTCCTCTCTCGCCTCACCGATTCGCTCC
PoARF1b-RT-F GCAGCAAAGTACTTCAAAGCCC Primers for qPCR
PoARF1b-RT-R CTCAGCCAGCATTCGCATC
Po18S rRNA-RT-For2 ATGGCCGTTCTTAGTTGGTG GenBank accession
no. EF126037.1
Po18S rRNA-RT-Rev2 CACACGCTGATCCAGTCAGT
PoARF1b-ORF F ATGGGACAGTTCTTTAGCCTGTTTAAAG Primers for the construction of pEGFP CI
PoARF1b-ORF R TCATTTTATGTTCTTGAGCTGGTTTGAAAG
Xhol-PoARF1b-F CCGCTCGAGCTATGGGACAGTTCTTTA
Xpnl-PoARF1b-R CGGGGTACCTCATTTTATGTTCTTGAGCTG
PoARF1bT30N-F CTGCATGCTGGAAAGAACACCATCCTGTACAAA Primers for the site-directed mutation
PoARF1bT30N-R TTTGTACAGGATGGTGTTCTTTCCAGCATGCAG
PoARF1bQ70L-F GTCGGTGGTCTGGACAAGATCAGGCCACTC
PoARF1bQ70L-R GAGTGGCCTGATCTTGTCCAGACCACCGAC