Skip to main content

Table 1 Specific primer for S. parauberis detection

From: Application of tylosin antibiotics to olive flounder (Paralichthys olivaceus) infected with Streptococcus parauberis

Primer Sequences (5′ → 3′) Target gene Product size (bp)
Spa2152 TTTCGTCTGAGGCAATGTTG 23 s rRNA 718 bp
Spa2870 GCTTCATATATCGCTATACT