Skip to main content

Table 1 Nucleotide sequences of primers used in reverse-transcription polymerase chain reaction (RT-PCR) analysis of adductor muscles of the Pacific oyster Crassostrea gigas

From: Role of the insulin-like growth factor system in gonad sexual maturation in Pacific oyster Crassostrea gigas

GeneAccession no.Sequence (5′–3′)Amplicon (bp)
CIRAJ535669(F)-TGAGGAGGGTGATGAGGATA
(R)-ATTGCACTGTAGGGATTGGA
375
IGFBP-ALSXP_011442465.1(F)-CTTGCCCTGAAAACCCTACA
(R)-GGGCAAGTAGCAGAATTTGG
500
MIPXM_011417420.2(F)-TAAATACAAGCGGTCGGGTG
(R)-AGATCCTTTCTTCTTGCGGC
214
Gyc76CXM_011452292.2(F)-ATGAATGCAGTGAATCGCTTGA
(R)-TGATACTGTGCAGCTCTTGG
274
VgAB084783.1(F)-ATGCTGGAGATGAACCTTGAG
(R)-TGCTTCGTGGTGGATATCCT
273
EF1αAB122066.1(F)–CCACTGGCCATCTCATTTAC
(R)–TGTTGACACCAATGATGAGC
393
  1. bp, base pairs; F, forward; R, reverse; CIR, C. gigas insulin receptor-related receptor; IGFBP-ALS, insulin-like growth factor binding protein complex acid labile subunit; MIP, molluscan insulin-related peptide; Gyc76C, receptor-type guanylate cyclase; Vg, vitellogenin