Skip to main content

Table 1 Sequence, efficiency and correlation coefficient of the primers used in the present study

From: Validation of housekeeping genes as candidate internal references for quantitative expression studies in healthy and nervous necrosis virus-infected seven-band grouper (Hyporthodus septemfasciatus)

GenePrimer sequence (5′-3′)Efficiency E (%)Correlation coefficient (R2)
Actin-βAGCAGGAGTACGATGAGTCC
GTATGCAGAGCCAGTCGTTTG
1020.995
Glyceraldehyde-3-phoospate dehydrogenase (GAPDH)TGCCCACGCAAACATCATTC
TGAATGCCATGCCTGTCAGC
1040.994
Acidic ribosomal protein (ARP)GCCACGTGGAAGTCCAACTA
ACAGACGGATGGTCTGCATC
1010.999
Elongation factor 1-α (EF1α)CGAGAAGTTCGAGAAGGAAGC
GATGAGCTGCTTCACACCAAG
1000.992