Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences for RT-PCR, amplicon size, PCR efficiencies, and GenBank accession numbers of the genes evaluated in this study. Primers were designed based on Crassostrea gigas sequences. F forward primer, R reverse primer, AT annealing temperature

From: Regulation of adductor muscle growth by the IGF-1/AKT pathway in the triploid Pacific oyster, Crassostrea gigas

Gene Accession number Sequence (5′–3′) Amplicon size (bp) PCR cycle AT (°C)
EF1α AB122066.1 (F) CCACTGGCCATCTCATTTAC 393 20 60
(R) TGTTGACACCAATGATGAGC
IGF-1 XM_011417420.2 (F) ATGGTTTGCCCTGTCTTGAG 336 25 55
(R) AGATCCTTTCTTCTTGCGGC
IGF-IR AJ535669.1 (F) TGAGGAGGGTGATGAGGATA 375 25 55
(R) ATTGCACTGTAGGGATTGGA
IGF-ALS XM_011417921.2 (F) ATGTCCAAAACAATGCGTCT 359 25 55
(R) TCCAAAACGCGTAACTTTTC
Actin-2 EKC31894.1 (F) TTTCGCCGGAGATGATGCCC 434 20 60
(R) TGGGGACAGTGTGGGTGACA
Myosin EKC37566.1 (F) TTTGGCTGGTGAGGCACAGG 544 20 60
(R) TTTGCTGAGCTGGCGTTGGA
Troponin T XM_020062462.1 (F) AGGAACGCGAGAAAGAACAA 375 20 60
(R) TGATCCTCTGGGACAGGAAG
Troponin I XM_011455869.2 (F) CCACCCTGGAGGAAGAAGTC 187 20 60
(R) AAATTGCCACGGAAATCTGA
Tropomyosin NM_001308906.1 (F) GCCATGAAAATGGAGAAGGA 381 20 60
(R) GGCGTTATTGAGGTTTTCCA