Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Two sex-specific SNP assays developed in this study

From: Identification of sex-specific SNPS in burbot Lota lota using RAD sequencing: conservation and management applications

Assay Name Complete sequence Forward primer sequence Reverse primer sequence VIC probe FAM probe
Llo186187_37 TGCAGCGCACCTGTGAAGGGGTATGAATAGAGGGGGG[G/T]GTGTGAACCCAGAGCTGCCAGACTGACTGGCGCCG TGCAGCGCACCTGTGAA CGGCGCCAGTCAGTCT TTCACACCCCCCCCTC TTCACACACCCCCCTC
Llo100864_67 TGCAGATGCAGGTGTGATCCTTCATGTCTGAACGGTCCCCTGGTGACACCAGCATCAGTCACTGTCTGG[C/G]CTGCTCTGCTCTCCTGGCCCCTCTCCCTCCCGCTGT ACGGTCCCCTGGTGACA ACAGCGGGAGGGAGAGG AGTCACTGTCTAGGCTGC CACTGTCTGGGCTGC