Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Sequence of the primers used in this study

From: Ethanol extract separated from Sargassum horneri (Turner) abate LPS-induced inflammation in RAW 264.7 macrophages

Gene Primer Sequence from 5′ → 3′
GAPDH Sense AAGGGTCATCATCTCTGCCC
Antisense GTGATGGCATGGACTGTGGT-
iNOS Sense ATGTCCGAAGCAAACATCAC
Antisense TAATGTCCAGGAAGTAGGTG
COX2 Sense CAGCAAATCCTTGCTGTTCC
Antisense TGGGCAAAGAATGCAAACATC