Skip to main content

Advertisement

Table 1 Primers used for the mitochondrial genome of Sardinella jussieu

From: Characterization of the complete mitochondrial genome of Mauritian sardinella, Sardinella jussieu (Lacepède, 1803), collected in the Banten Bay, Indonesia

Name Sequence (5' to 3') Product size (bp)
Fish F1 TCAACCAACCACAAAGACATTGGCAC 652
Fish R1 TAGACTTCTGGGTGGCCAAAGAATCA
GLUDG-L TGACTTGAARAAYCGTTG 451
GB2-H CCCTCAGAATGATATTTGTCCTCA
CYTB-F GCCTACGAAAAACCCACCCGCTCC 8.2 k
CO1-R GTAAGGTCTACGGATGCCCCTGCG
CYTB-R AACGGAGGAGAAAGCGGTTGCGATG 8.7 k
CO1-F CTTCCTGCTTCTCCTGGCCTCCTC
SARD F TTAAAGTCCTCCCTGAGGCCC 683
SARD R TTAGGAGGGAGTCGTCAAATGC