Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 3 Primers and probes used for one-step quantitative real-time RT-PCR

From: Butyrate and taurine exert a mitigating effect on the inflamed distal intestine of European sea bass fed with a high percentage of soybean meal

Gene Nucleotide sequence (5′–3′)
IL-1β F: TTGTGTTTGAGCGCGGAACA
R: TGTCGGTCACGCTGCATTG
Probe: 6-Fam-CTCCAACAGCGCAGTACAGCAAGC-BHQ1
IL-6 F: GCCTGCTCACTTACACAGCTCTTC
R: TCTTGAAACTGTGGCCCTCTGA
Probe: 6-Fam-AGAAGGAGTCCCCCAGCTCGATCCG-BHQ1
IL-8 F: CTGTCGCTGCATCCAAACAGA
R: GCAATGGGAGTTAGCAGGAATCAG
Probe: 6-Fam-AGCAAACCCATCGGCCGCCAC-BHQ1
IL-10 F: AGCGCTGCTAGACCAGACTGT
R: CGGCAGAACCGTGCTTAGAT
Probe: 6-Fam-AGACACTTTAAAGACCCCGTTCGCTTGC-BHQ1
TNFα F: AAACCGGCCTCTACTTCGTCTA
R: TCCCGCACTTTCCTCTTCAC
Probe: 6-Fam-AGCCAGGCGTCGTTCAGAGTCTCC-BHQ1