Skip to main content

Table 2 Sequences and melting temperatures (Tm) of the primers used for in vitro synthesis of standard mRNAs

From: Butyrate and taurine exert a mitigating effect on the inflamed distal intestine of European sea bass fed with a high percentage of soybean meal

Gene GenBank acc. nr. Nucleotide sequence (5′–3′) Tm (°C)
IL-1β AJ269472 F: gtaatacgactcactatagggTGCCATGGAGAGACTGAAGG >70
R: ACTGGGTGTACGGTCCAAGT 60.7
IL-6 AM490062 F: gtaatacgactcactatagggACTTCCAAAACATGCCCTGA >70
R: CCGCTGGTCAGTCTAAGGAG 59.5
IL-8 AM490063 F: gtaatacgactcactatagggTCAGTGAAGGGATGAGTCTGA >70
R: CTCGGGGTCCAGGCAAAC 60.3
IL-10 AM268529 F: gtaatacgactcactatagggCAGTGCTGTCGTTTTGTGGA >70
R: TCACTCTTGAGCTGGTCGAAG 59.7
TNFα DQ070246 F: gtaatacgactcactatagggCACTACACACTGAAGCGCAT >70
R: CTGTAGCTGTCCTCCTGAGC 59.5