Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Summary on housekeeping reference genes and qPCR assay conditions used in this study

From: Evaluation of reference genes for RT-qPCR study in abalone Haliotis discus hannai during heavy metal overload stress

Gene Description Accession no. Primer sequence (5′–3′) Amplicon size (bp) PCR (E)a R 2 valueb
ACTB Cytoskeletal β-actin AY380809.1 FW: GGTATTGTTCTGGACTCTGG 162 1.968 0.996
B-TU β-tubulin EF103431.1 FW: ACATTCACTAGGTGGGGGTA 161 1.976 0.998
EF1A Elongation factor-1 alpha JX002677.1 FW: GCTCTCTGGAAGTTTGAGAC 165 1.974 0.994
GAPDH Glyceraldehyde-3-phosphate dehydrogenase ABO26632.1 FW: ACCGCTACACAGAAGACAGT 177 1.912 0.995
PPIB Peptidyl-prolyl cis-trans isomerase B KP698942 FW: CGAGAAAGCAGGACGAATTG 171 1.977 0.993
RPL3 Ribosomal protein L3 KP698943 FW: TCATTGCACACACCCAGACT 168 1.911 0.997
RPL4 Ribosomal protein L4 KP698944 FW: GCTGCTTCAAGACCGCTTAT 176 2.013 0.992
RPL5 Ribosomal protein L5 ABO26701.1 FW: AGATGAGGATGGCAAACCAG 168 1.937 0.996
RPL7 Ribosomal protein L7 KP698945 FW: CAAGCTGAACACTCCAAACG 156 1.997 0.994
RPL7A Ribosomal protein L7A KP698946 FW: GCTGTCGAAAAAGGTTGAGC 165 1.972 0.995
RPL8 Ribosomal protein L8 KP698947 FW: TGGAAACTACGCCACAGTCA 161 1.944 0.995
UBE2 Ubiquitin-conjugating enzyme E2 KP698948 FW: CCAAGCTCTTCTTAGTGCAC 170 1.954 0.997
  1. aPCR efficiency
  2. bDetermination coefficient