Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Oligonucleotide primers used for the RT-PCR and quantitative real-time PCR to analyze mRNA expression of PLC-β1

From: Expression of phospholipase C β1 in olive flounder (Paralichthys olivaceus) following external stress stimulation

Primer name 5′-3′ sequence Description
β-actin-F GACATGGAGAAGATCTGGCA For RT-PCR and real-time qRT-PCR
GenBank accession no AU090737
β-actin-R ATGTCCTGCTCGAAGTCCAG
18 s rRNA-F GTTGGTGGAGCGATTTGTCTGG For RT-PCR and real-time qRT-PCR
GenBank accession no DQ267937
18 s rRNA-R CATCTAAGGGCATCACAGACCTG
IL-1β-F AACAGCCAAGGCAAAGATTG For RT-PCR and real-time qRT-PCR
GenBank accession no AB070835
IL-1β-F AATGTCCAGCTCCTCCTTCA
IL-6-F TGGGCATCAACTCGGGCTAC For RT-PCR and real-time qRT-PCR
GenBank accession no DQ267937
IL-6-R CGAAGGCCACAGATTGGTC
PoPLC-β1-F CAACGTGATGGAGCAAAGAG For RT-PCR and real-time qRT-PCR
PoPLC-β1-R GGTGTGTGGCTCAGTCCGTT