Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences used in this study

From: Establishment and long-term culture of the cell lines derived from gonad tissues of Siberian sturgeon (Acipenser baerii)

Genes Primer sequences (5′ > 3′) Product size (bp) Accession number
cyp17a1 Forward, TCACACACTCCAGTATTGGTG 92 HQ026486.1
lh Forward, CTGCAGAGAAGGAGGAATGT 140 AJ251656.1
sox9 Forward, AGCAGCAAAAACAAGCCTCA 113 EU241882.1
star Forward, CAGAAGTCAATCAGCATCCT 79 FJ205610.1
β-actin Forward, CCCTGTTCCAGCCATCCTTC 155 JX027376.1
  1. Primer sequences for ar, cyp17a1, lh, sox9, and star genes were referred from Berbejillo et al. (2012)
  2. ar androgen receptor, cyp17a1 cytochrome P450, family 17, subfamily a, polypeptide 1, lh luteinizing hormone, sox9 sry-box containing gene 9, star steroidogenic acute regulatory protein